Quiet essentials · Free shipping over $75 · Shop the edit

TRAP100 (K834) Polyclonal Antibody-BS1889 Size:50µl The easy and efficient reagent

SKU: 30163314421

4.1
USD130.12 USD176.12

Pay in 4 interest-free payments of $32.53 Learn more

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jul 28 - Aug 2

Description

The easy and efficient reagent for transfection of mammalian cells with DNA

Swiss-Prot: P57087

AA Sequence: CAGCTGCTGTTCAATAAAACCAAAAGCGTGGAATTCACCTTCTGCAATGATACCGTGGTGATTCCGTGCTTCGTGACCAATATGGAAGCCCAGAATACCACCGAAGTGTATGTGAAATGGAAATTCAAAGGTCGTGATATCTATACCTTCGATGGTGCACTGAATAAAAGCACCGTGCCGACCGACTTCAGCAGTGCAAAAATTGAAGTGAGCCAGCTGCTGAAAGGTGATGCAAGTCTGAAAATGGATAAAAGCGATGCAGTTAGTCATACCGGTAATTATACCTGCGAAGTGACCGAACTGACCCGTGAAGGCGAAACCATTATTGAACTGAAATATCGTGTTGTGAGTTGGTTCAGCCCGAATGAA

DF10021-200

TRAP100 (K834) Polyclonal Antibody-BS1889 Size:50µl The easy and efficient reagentTRAP100 (K834) Polyclonal Antibody Catalogue Numbers: BS1889 50, BS1889 100 Product: Rabbit IgG, 1mg ml in PBS with 0. 02% sodium azide, 50% glycerol, pH7. 2 Swiss Prot: O75448 Host: Rabbit Reactivity: Human, Mouse, Rat Applications: IHC, IF All Applications: IHC: 1: 50~1: 200 IF: 1: 50~1: 200 Background: In mammalian cells, transcription is regulated in part by high molecular weight coactivating complexes that mediate signaling between

Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

You may also like

recommand products